nthseq

 

Function

Writes one sequence from a multiple set of sequences

Description

In EMBOSS, when an application has to write out many sequences, the normal style is to write them all into one file containing multiple sequences.

This default behaviour can be changed by using the qualifier '-ossingle' which writes many sequences into many files, each containing one sequence.

The program seqretsplit will take a file containing many sequences and will output many files, each containing one sequence. However you have no choice over the naming of the files - they are named after the ID name fo the sequence they contain.

If, however you have the situation where you have a file containing multiple sequences and you wish to extract one of them, then this application may be useful.

nthseq allows you to specify the name of the output file, so you may find that it is useful to include this program in scripts where you need to be able to specify the name of the resulting sequence files you create.

This application extracts the indicated sequence from a multiple set of sequences and writes it out.

Usage

Here is a sample session with nthseq


% nthseq 
Writes one sequence from a multiple set of sequences
Input (gapped) sequence(s): tembl:eclac*
The number of the sequence to output [1]: 2
output sequence [eclac.fasta]: 

Go to the input files for this example
Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     (Gapped) sequence(s) filename and optional
                                  format, or reference (input USA)
   -number             integer    [1] The number of the sequence to output
                                  (Integer 1 or more)
  [-outseq]            seqout     [.] Sequence filename and
                                  optional format (output USA)

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outseq" associated qualifiers
   -osformat2          string     Output seq format
   -osextension2       string     File name extension
   -osname2            string     Base file name
   -osdirectory2       string     Output directory
   -osdbname2          string     Database name to add
   -ossingle2          boolean    Separate file for each entry
   -oufo2              string     UFO features
   -offormat2          string     Features format
   -ofname2            string     Features file name
   -ofdirectory2       string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write standard output
   -filter             boolean    Read standard input, write standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Standard (Mandatory) qualifiers Allowed values Default
[-sequence]
(Parameter 1)
(Gapped) sequence(s) filename and optional format, or reference (input USA) Readable sequence(s) Required
-number The number of the sequence to output Integer 1 or more 1
[-outseq]
(Parameter 2)
Sequence filename and optional format (output USA) Writeable sequence  
Additional (Optional) qualifiers Allowed values Default
(none)
Advanced (Unprompted) qualifiers Allowed values Default
(none)

Input file format

nthseq reads a a normal sequence USA.

Input files for usage example

'tembl:eclac*' is a sequence entry in the example nucleic acid database 'tembl'

Output file format

The output is the specified ordinal sequence from the input USA.

In the example, the second sequence from the input file will be written out to the specified output file.

Output files for usage example

File: eclac.fasta

>ECLACA X51872.1 Escherichia coli lacA gene for thiogalactoside transacetylase
gtgaatgaagtcgcttaagcaatcaatgtcggatgcggcgcgacgcttatccgaccaaca
tatcataacggagtgatcgcattgaacatgccaatgaccgaaagaataagagcaggcaag
ctatttaccgatatgtgcgaaggcttaccggaaaaaagacttcgtgggaaaacgttaatg
tatgagtttaatcactcgcatccatcagaagttgaaaaaagagaaagcctgattaaagaa
atgtttgccacggtaggggaaaacgcctgggtagaaccgcctgtctatttctcttacggt
tccaacatccatataggccgcaatttttatgcaaatttcaatttaaccattgtcgatgac
tacacggtaacaatcggtgataacgtactgattgcacccaacgttactctttccgttacg
ggacaccctgtacaccatgaattgagaaaaaacggcgagatgtactcttttccgataacg
attggcaataacgtctggatcggaagtcatgtggttattaatccaggcgtcaccatcggg
gataattctgttattggcgcgggtagtatcgtcacaaaagacattccaccaaacgtcgtg
gcggctggcgttccttgtcgggttattcgcgaaataaacgaccgggataagcactattat
ttcaaagattataaagttgaatcgtcagtttaaattataaaaattgcctgatacgctgcg
cttatcaggcctacaagttcagcgatctacattagccgcatccggcatgaacaaagcgca
ggaacaagcgtcgcatcatgcctctttgacccacagctgcggaaaacgtactggtgcaaa
acgcagggttatgatcatcagcccaacgacgcacagcgcatgaaatgcccagtccatcag
gtaattgccgctgatactacgcagcacgccagaaaaccacggggcaagcccggcgatgat
aaaaccgattccctgcataaacgccaccagcttgccagcaatagccggttgcacagagtg
atcgagcgccagcagcaaacagagcggaaacgcgccgcccagacctaacccacacaccat
cgcccacaataccggcaattgcatcggcagccagataaagccgcagaaccccaccagttg
taacaccagcgccagcattaacagtttgcgccgatcctgatggcgagccatagcaggcat
cagcaaagctcctgcggcttgcccaagcgtcatcaatgccagtaaggaaccgctgtactg
cgcgctggcaccaatctcaatatagaaagcgggtaaccaggcaatcaggctggcgtaacc
gccgttaatcagaccgaagtaaacacccagcgtccacgcgcggggagtgaataccacgcg
aaccggagtggttgttgtcttgtgggaagaggcgacctcgcgggcgctttgccaccacca
ggcaaagagcgcaacaacggcaggcagcgccaccaggcgagtgtttgataccaggtttcg
ctatgttgaactaaccagggcgttatggcggcaccaagcccaccgccgcccatcagagcc
gcggaccacagccccatcaccagtggcgtgcgctgctgaaaccgccgtttaatcaccgaa
gcatcaccgcctgaatgatgccgatccccaccccaccaagcagtgcgctgctaagcagca
gcgcactttgcgggtaaagctcacgcatcaatgcaccgacggcaatcagcaacagactga
tggcgacactgcgacgttcgctgacatgctgatgaagccagcttccggccagcgccagcc
cgcccatggtaaccaccggcagagcggtcgac

Data files

None.

Notes

It may be useful to use this application in a small script that extracts all sequences from a multiple sequence file and explicitly names the output files in the way that you require.

For example:

#!/usr/local/bin/perl -w
if ($#ARGV !=1) {
  die "Usage: scriptname in out\n";
}
$count=1;
@list = `infoseq $ARGV[0] -auto -only -name`;
while ($count <= $#list+1) {
  system("nthseq -auto $ARGV[0] -n $count $ARGV[1]-$count.seq");
  $count++;
}

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with a status of 0.

Known bugs

None.

See also

Program nameDescription
biosed Replace or delete sequence sections
codcopy Reads and writes a codon usage table
cutseq Removes a specified section from a sequence
degapseq Removes gap characters from sequences
descseq Alter the name or description of a sequence
entret Reads and writes (returns) flatfile entries
extractfeat Extract features from a sequence
extractseq Extract regions from a sequence
listor Write a list file of the logical OR of two sets of sequences
makenucseq Creates random nucleotide sequences
makeprotseq Creates random protein sequences
maskfeat Mask off features of a sequence
maskseq Mask off regions of a sequence
newseq Type in a short new sequence
noreturn Removes carriage return from ASCII files
notseq Exclude a set of sequences and write out the remaining ones
pasteseq Insert one sequence into another
revseq Reverse and complement a sequence
seqret Reads and writes (returns) sequences
seqretsplit Reads and writes (returns) sequences in individual files
skipseq Reads and writes (returns) sequences, skipping first few
splitter Split a sequence into (overlapping) smaller sequences
trimest Trim poly-A tails off EST sequences
trimseq Trim ambiguous bits off the ends of sequences
union Reads sequence fragments and builds one sequence
vectorstrip Strips out DNA between a pair of vector sequences
yank Reads a sequence range, appends the full USA to a list file

The program seqretsplit will take a file containing many sequences and will output many files, each containing one sequence. However you have no choice over the naming of the files - they are named after the ID name fo the sequence they contain.

Author(s)

Gary Williams (gwilliam © rfcgr.mrc.ac.uk)
MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK

History

Written (2000) - Gary Williams

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None