![]() |
union |
It is most useful when the input sequences are specified in a List file. The List file (file of sequence names) can be any set of sequences in files or database entries specified in the normal EMBOSS USA (which can include the spcification of sub-regions of the sequence, eg. 'em:hsfau[20,55]'). Specifying several such subregions in a sequence or sequences allows you to enter disjoint sequences to be joined.
the file 'cds.list' contains a list of the regions making up the coding sequence of 'embl:hsfau':
% union Reads sequence fragments and builds one sequence Input sequence(s): @../../data/cds.list Output sequence [hsfau1.fasta]: |
Go to the input files for this example
Go to the output files for this example
Standard (Mandatory) qualifiers: [-sequence] seqall Sequence database USA [-outseq] seqout Output sequence USA Additional (Optional) qualifiers: (none) Advanced (Unprompted) qualifiers: (none) Associated qualifiers: "-sequence" associated qualifiers -sbegin1 integer First base used -send1 integer Last base used, def=seq length -sreverse1 boolean Reverse (if DNA) -sask1 boolean Ask for begin/end/reverse -snucleotide1 boolean Sequence is nucleotide -sprotein1 boolean Sequence is protein -slower1 boolean Make lower case -supper1 boolean Make upper case -sformat1 string Input sequence format -sdbname1 string Database name -sid1 string Entryname -ufo1 string UFO features -fformat1 string Features format -fopenfile1 string Features file name "-outseq" associated qualifiers -osformat2 string Output seq format -osextension2 string File name extension -osname2 string Base file name -osdirectory2 string Output directory -osdbname2 string Database name to add -ossingle2 boolean Separate file for each entry -oufo2 string UFO features -offormat2 string Features format -ofname2 string Features file name -ofdirectory2 string Output directory General qualifiers: -auto boolean Turn off prompts -stdout boolean Write standard output -filter boolean Read standard input, write standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report deaths |
Standard (Mandatory) qualifiers | Allowed values | Default | |
---|---|---|---|
[-sequence] (Parameter 1) |
Sequence database USA | Readable sequence(s) | Required |
[-outseq] (Parameter 2) |
Output sequence USA | Writeable sequence | <sequence>.format |
Additional (Optional) qualifiers | Allowed values | Default | |
(none) | |||
Advanced (Unprompted) qualifiers | Allowed values | Default | |
(none) |
tembl-id:HSFAU1[782:856] tembl-id:HSFAU1[951:1095] tembl-id:HSFAU1[1557:1612] tembl-id:HSFAU1[1787:1912] |
You may find the program yank useful for creating List files.
>HSFAU1 X65921.1 H.sapiens fau 1 gene atgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacg gtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtc gtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggag gccctgactaccctggaagtagcaggccgcatgcttggaggtaaagtccatggttccctg gcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaag aagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtg cccacctttggcaagaagaagggccccaatgccaactcttaa |
The result is a normal sequence file containing a single sequence resulting from the concatenation of the input sequences.
Program name | Description |
---|---|
biosed | Replace or delete sequence sections |
cutseq | Removes a specified section from a sequence |
degapseq | Removes gap characters from sequences |
descseq | Alter the name or description of a sequence |
entret | Reads and writes (returns) flatfile entries |
extractfeat | Extract features from a sequence |
extractseq | Extract regions from a sequence |
listor | Writes a list file of the logical OR of two sets of sequences |
maskfeat | Mask off features of a sequence |
maskseq | Mask off regions of a sequence |
newseq | Type in a short new sequence |
noreturn | Removes carriage return from ASCII files |
notseq | Excludes a set of sequences and writes out the remaining ones |
nthseq | Writes one sequence from a multiple set of sequences |
pasteseq | Insert one sequence into another |
revseq | Reverse and complement a sequence |
seqret | Reads and writes (returns) sequences |
seqretsplit | Reads and writes (returns) sequences in individual files |
skipseq | Reads and writes (returns) sequences, skipping the first few |
splitter | Split a sequence into (overlapping) smaller sequences |
trimest | Trim poly-A tails off EST sequences |
trimseq | Trim ambiguous bits off the ends of sequences |
vectorstrip | Strips out DNA between a pair of vector sequences |
yank | Reads a sequence range, appends the full USA to a list file |
You may find the program yank useful for creating List files.